![]() You should see three new folders inside FAST-iCLIP: docs, rawdata, and results.Īdd the following lines to your ~/.bashrc and ~/.bash_profile: If you do not have sudo privileges, run python setup.py install -user or python setup.py install -prefix=. The annotations are compatible only with the tools specificed in the following. Please wait until all annotations are downloaded and extracted. Note that the configure will download a very large annotation file from Amazon that contains all necessary annotation files to run the pipeline. This will check for dependencies (below) and download necessary files (bowtie indices, gene lists and genomes, and example iCLIP data). git clone if you use ssh authentication.Default is 8.Ĭlone this repository by running one of the following: Percentage of bases that must have quality > q during filtering. Minimum average quality score allowed during read filtering. Minimum MAPQ (Bowtie alignment to repeat/tRNA/retroviral indexes) score allowed. Default is 1,4 (1 sample) 2,3 (2 samples) x,2 (x>2 samples) M,n: at least m samples must each have at least n RT stops mapped to nonrepeat RNAs. M,n: at least m samples must each have at least n RT stops mapped to viral genome. M,n: at least m samples must each have at least n RT stops mapped to repeat RNAs. Default is AGATCGGAAGAGCGGTTCAGCAGGAATGCCGAGACCGATCTCGTATGCCGTCTTCTGCTTG. If using irCLIP RT primers, this value should be 18.ģ' adapter to trim from the end of each read. Number of bases to trim from 5' end of each read. Name of directory where output directory will be made Required arguments flagĪt least one input FASTQ (or fastq.gz) files separated by spaces We will release details of generating annotation files for other genomes shortly in future. ![]() This is due to a tailored set of annotations used in the pipeline. Note that the current pipeline is compatible with only GRCh38 (human) and GRCm38 (mouse) assemblies. The pdf in the repository contains further instructions for using the iPython notebooks.įasticlip -i INPUT -n NAME -o OUTPUT Įxample: fasticlip -i rawdata/example_MMhur_R1.fastq rawdata/example_MMhur_R2.fastq -GRCm38 -n MMhur -o resultsĮxample: fasticlip -i rawdata/example_Hmhur_R1.fastq rawdata/example_Hmhur_R2.fastq -GRCh38 -n Hmhur -o results The following README will focus mainly on fasticlip. This package contains two main sets of tools: an executable called fasticlip to run iCLIP on human and mouse data, and several (possibly deprecated) iPython notebooks to process iCLIP data from viral genomes. Ultraefficient irCLIP pipeline for characterization for protein-RNA interactions. Zarnegar B, Flynn RA, Shen Y, Do BT, Chang HY, Khavari PA. Fully Automated and Standardized iCLIP (FAST-iCLIP) is a fully automated tool to process iCLIP data.
0 Comments
Leave a Reply. |
AuthorWrite something about yourself. No need to be fancy, just an overview. ArchivesCategories |